Expedition 15:
Jan. 2 - 22, 2014
|
Read questions and answers in the Mail Buoy» January 12, 2014 Mail BuoyJanuary 30 responses:When analyzing genes, what do you hope to find? Dear Talia, That is a very good question. Mostly, when we look at genes, we look at one of two things: the first is the function of the genes, and the second is information about the type of organism they came from. First, about function. It works roughly like this: 1. Scientists who work with bacteria in the laboratory do tests to determine which genes are responsible for specific functions in a microbe, like movement or the microbe’s ability to attach to a solid surface. 2. They then record the specific order of chemicals that make up each gene (every gene is made up of a long chain, or “sequence” of four chemicals: guanine, thymine, adenine, and cytosine, which we call G,T,A, and C for short). In a bacterium similar to those living at vents, the sequence of a gene that lets them use oxygen is: ATGGAAAATCGTCCATTAGAGTACGACTACACAATTGCTAAGATGTTTATGCTTACAACCATCGTCTTAGGAATTGTCGGAATGCTCATCGGTGTA 3. Now, after we take a sample at the vents, we can sequence some of DNA of the organisms we collect by breaking open their cells and “reading” the sequence of their DNA. If the sequence is similar to the above one, we might guess that the organisms use oxygen! 4. Next, you might compare bacteria living in two different environments to see if this gene is very common in both, and maybe you could make some conclusions about the bacteria there and whether or not they use oxygen. That’s just one example, but when we try to figure out the function of other genes, the basic idea is the same. Everything else is just details! So that's what the organisms might be doing. The second thing we can learn from genes is “who” the organisms are. How do we do that? It works something like this: 1. First, we locate a gene in the microbe that’s common to all living things (it's an essential gene that everybody, from humans to bacteria, needs for making proteins). 2. Compare the DNA sequence of this gene to the sequence that appears in other organisms, because although we all have this gene, its exact sequence varies from species to species. 3. Group the organisms together based on the similarity in this DNA sequence. The more similar the DNA sequence is in two organisms, the closer the organisms are related. 4. Make a 'bacterial family tree' based on the DNA sequence similarity. Once we have this family tree, when we collect a bacterial sample we can specifically target this shared DNA sequence and know where those bacteria are on the tree! This can be useful because some bacteria have specific functions or adaptations to their environment, and it can give you an indication of how diverse the environment might be. Just like the rain forest is very diverse in terms of animals and plants and the arctic is not, there are environments where microbes are very diverse and some where they are not. Hope that answers your question! Jesse McNichol
Can Archaebacteria move on their own and colonize other vents? Nate Diamond Middle School Lexington, Mass. Dear Nate, Thanks,
Will you try to keep the bacteria alive that you bring up from the vents? Will you keep all the specimens? Can you preserve the bacteria to study years later? Tiernan Dear Tiernan, During this cruise, some of us performed incubations of bacteria directly on board the ship. When we do that, we don’t preserve the bacteria to grow them later in the laboratory, but rather we collect them to extract their DNA and study their genes. However, you are right, it is a very good idea to also preserve some samples for later cultivation, and some researchers did exactly that during our cruise. This is actually how most cultivated bacteria have been isolated in the past: First, collect your favorite environmental samples, then store the cells in a freezer and try to grow the microbes later in the laboratory. When we do that, however, we need to be careful with the way we preserve the cells! As you know, cells are mostly made up of water, and water freezes below 0˚C. If we were to freeze the bacteria directly, tiny ice crystals would form inside the cells, which would break their membranes and damage their proteins, so it would be impossible to grow them later. The solution is to prevent the formation of the ice crystals by adding a special chemical. We commonly use glycerol, which is a viscous compound (think of a thick maple syrup) and does not freeze like water. This way, we can store the bacteria in a freezer at -80˚C (-112˚F) and "revive" them years later! Thanks for following our adventure!
What has been the most interesting discovery on the ship so far that most of the scientists are excited and talking about? Dear Kate, Luisa, and Andrea, One of the most talked-about discoveries on this cruise is a new vent site nicknamed “Teddy Bear.” Its unique feature is that all of the rocks near it are covered with a “hairy” coating of bacteria that sways back and forth in the currents. [You can see a video of Teddy Bear here.] The scientists on board took a lot of samples of those rocks, and will analyze the microbes when they get back to shore to find out more about them. Another surprise was that a vent site called “Trick or Treat,” which used to be very active, has gone extinct, meaning that no more fluid is coming out of it. When that happens, all of the tubeworms and mussels living at the site die off. Thanks for writing!
How does the chemosynthesis work on molecular level under such high pressure? Dear Selina, Lisa, Steffi, Marcel, Nico, Jan, and Jana, The microorganisms that thrive near hydrothermal vents have adapted to the high pressures of deep sea. Exactly how they cope with these sorts of pressures hasn’t yet been fully explained by scientists, but it appears to have something to do with the structure of their cell membrane, which is the outermost part of the microbe (think of it like a microbe’s “skin”). These membranes have organic molecules in them that make them flexible and able to compensate for the high pressure of the water column. Best,
Is there a big difference between working on a ship and working under “normal conditions?” Good question! Yes, there is definitely a big difference. Even after being at sea for a month, there are many things that I’m still getting used to. Maintaining contact with people on shore can be very difficult, for example—we have an internet connection via satellite, but it is often very slow or unreliable. I have to take that into account daily when posting dispatches on the Dive and Discover website. The fact that the ship is constantly rocking back and forth is a challenge as well. When we hit rough weather a few days ago, my laptop almost slid off of a desk and onto the floor! Also, if a piece of equipment fails or a computer problem occurs, we have to try to improvise and fix it with the resources we have on board—after all, you can’t just go out to a store when you’re in the middle of the ocean. As for the scientists, working on a ship means that they need to adapt in subtle ways as well. François Thomas and Jesse McNichol, for example, need to use a microscope to count bacteria in their samples—but the rocking of the ship pulls their slides in and out of focus, which makes their job very difficult. The motion of the ship also means that the scientists can’t weigh chemicals for their experiments once they’re on board, since the constant rocking would throw off sensitive scales. To get around this problem, they weigh out specific amounts of chemicals before they board the ship, and put them in individual containers. I hope this answers your question! Best,
If pressure increases, the solubility of calcium carbonate increases too, but the mussels and the clams at the vents still build shells. Is there a mechanisms known by which they solve this problem? Hello Esther, WHOI biogeochemist Dan McCorkle answered this for us. He studies calcification by marine organisms and how that process might be affected by ocean acidification. Here’s what he had to say: 1. While carbonate mineral solubility increases with pressure (which is related to depth), the bottom water at the vent depth is likely still supersaturated with respect to calcite (one form of calcium carbonate), and perhaps with respect to aragonite (another form of CaCO3). That is, it is not as strongly supersaturated as the water at shallower depth, but it is probably not undersaturated. In other words, there is still plenty of calcium carbonate available for the organisms to use to build their shells.
How do the microbes convert chemicals in the water into energy? Do they have special enzymes or genes? That’s a great question. The microbes don’t exactly “convert” chemicals into energy. They can, however, harness the energy that is released during certain chemical reactions. Like all organisms, microbes use enzymes to carry out those reactions inside the cell. In case of the chemosynthetic microbes at vents, they do that with specific enzymes that allow them to capture the energy released in a redox reaction such as the oxidation of hydrogen sulfide to sulfate with oxygen. Enzymes are proteins that make it easier for a cell to perform a specific chemical reaction. The enzymes involved in chemosynthesis are usually anchored in the membrane of the cell. As a result of the reaction, ATP is synthesized. ATP is the common energy ‘currency’ of all organisms. It stores energy in a chemical form that the cell can use later. In a way, the bacterial redox reaction is very similar to what happens in our cells when we oxidize sugars to carbon dioxide and reduce oxygen to water in the process. The enzymes used by these microbes are encoded in their genome (their DNA). When a cell needs the enzyme to carry out the reaction, the gene is transcribed into RNA, which is then translated into an enzyme (which is in a way a tool the cell needs to carry out the reaction). The gene is the blueprint for making the tool. Different microbes use different enzymes, depending on what kind of chemicals they utilize. We know all this by performing very detailed molecular and biochemical analyses of organisms that we can grow in the laboratory. When we find something similar in the environment, we can then assume that the enzyme is doing the same reaction there. Best, [P.S. from the editor—You can read more about chemosynthesis at hydrothermal vents in our final dispatch.]
|
Mailing List | Feedback | Glossary | For Teachers | About Us | Contact
© 2013 Dive and Discover™. Dive and Discover™ is a registered trademark of Woods
Hole Oceanographic Institution
